anastaciajohnson
anastaciajohnson anastaciajohnson
  • 01-03-2017
  • Mathematics
contestada

how many millilmeters are in 22 liters

Respuesta :

Аноним Аноним
  • 01-03-2017
22000. I believe it is the answer idk it could be wrong
Answer Link
Rileigh1991
Rileigh1991 Rileigh1991
  • 01-03-2017
22 mililiters hope that helps
Answer Link

Otras preguntas

which of the following school districts initiatives contribute to breaking the cycle of poverty? (select all that apply.) A) Provide nutritious meals B) Employ
A shark is 110 feet long.what is it's length in meters
Decide whether you would use tu or ud in each situation
1. How are minor parties different from major parties?
del ray can run 20 1/2 miles in 2 1/4 hours. how many miles per hour can he run?
PLS I NEED HELP FASTTT
Dean brings up the ambiguity branch managers at First National Bank face. He believes senior leadership needs to make it clear what managers' most important pri
(3x + 5y) + (8x-y-9)​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Chance spent $1,189 on textbooks during his freshman year at college. If he bought 13 textbooks, what was the average cost of each textbook?