Whydontwefan173
Whydontwefan173 Whydontwefan173
  • 04-04-2018
  • History
contestada

Which term is used to describe a fertilized egg?
A.Sperm
B.Testes
C.Uterus
D.Zygote

Respuesta :

rjparker
rjparker rjparker
  • 04-04-2018
its Zygote theres your answer
Answer Link
Аноним Аноним
  • 04-04-2018
The answer is, "Zygote". 
Answer Link

Otras preguntas

A mutation that occurs in the gametes of an organism will most likely be transferred where
The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.
True or false? physical factors affecting community health include geography, community size, and industrial development.
What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!
Identify the specific sensory receptors for each of the five common senses.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
which is a reason that protists are difficult to classify
The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?
Find f(x) if it is known that f(x−2)=2x−4.
Solve for x. Assume that lines which appear tangent are tangent.