tatyanatolbert2
tatyanatolbert2 tatyanatolbert2
  • 02-11-2017
  • Health
contestada

Which of these is a disadvantage of CT Scan technology ?

A. Increased numbers of surgeries

B. Inaccuracy

C.Radiation exposure

D.high cost

Respuesta :

pierrezonra pierrezonra
  • 02-11-2017
C is the correct answer
Answer Link
Yakavi Yakavi
  • 06-07-2022

Radiation exposure is a disadvantage of CT Scan technology .

What is a CT scan used for?

A CT scan can show detailed images of any part of the body, including the bones, muscles, organs and blood vessels.

Is CT scan harmful?

The amount of radiation is greater than you would get during a plain X-ray because the CT scan gathers more-detailed information.

Hence, C is the correct option

To learn more about CT scan , here

https://brainly.com/question/6714225

#SPJ2

Answer Link

Otras preguntas

What property is shown by the equation? 1. 0 ÷ (–6) = 0
does radiation need a phase of matter to travel with?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
How well did feudalism establish order in the Middle ages?
how do you say theatre in Spanish
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
how do you say theatre in Spanish