anitakumari82 anitakumari82

03-03-2015
Mathematics

contestada

ms rodriguez planted 24 tulips in her flower bed. of the tulips,1/3 are red. how many tulips are red?

Respuesta :

mariangel mariangel

03-03-2015

|__1/3(red)__|____1/3____|____1/3____| 24 tulips

24:3=8 tulips are red

Answer Link

Otras preguntas

Which constitutional amendment allowed voting for citizens who were eighteen or older?

Can I get some help with these questions thank you

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which is the correct way to rewrite the phrase? the house of Molly and Harriet A. Molly's and Harriet's house B. Molly and Harriet's house C. Mollies and Harrie

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions

How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?

Improved functional health can be a positive influence on which health risk/

What is the pianist and the weary blues doing when he makes the piano moan with Melody