morg55555 morg55555

01-03-2017
Biology

contestada

Decscribe the process of transcription and translation.

Respuesta :

biancazeelie biancazeelie

03-03-2017

In transcription, genetic information encoded in DNA is transferred to an RNA molecule. RNA is produced.

In translation, ribosomes in the cell's cytoplasm create protein.

Answer Link

minecraftrevor minecraftrevor

20-03-2019

ribosnes and eha the last guy said

Answer Link

Otras preguntas

paul has a standard deck of cards. what is the probability he will choose a 2?

Need Help Fast 33 points please Factor x2 + 10x – 18.

4/y+2 - 9/y-2 = 9/y^2-4

Solve the equation by the method of your choice. StartFraction 1 Over x EndFraction plus StartFraction 1 Over x plus 4 EndFraction equals one half The solution

Billy has 1 gallon of paint. He is going to pour it into a paint tray that measures 10 inches wide, 14 inches long, and 4 cm deep. Which of the following scenar

Lisa’s test grades are 79, 89, and 90. There will be one more test this year. If Lisa wants her test average to be at least 88, what is the lowest grade she can

Which of the following can be a cause of social change?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An important change in the american family in the nineteenth century was

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac