ChasenE27737 ChasenE27737
  • 03-11-2022
  • Mathematics
contestada

hjgrghyfghyfggfhvgfhgvhgf

Respuesta :

ShaiaU653354 ShaiaU653354
  • 03-11-2022

To draw the graph we must find at least two points on them

[tex]y=-6x+8[/tex]

Substitute x by 0 and find y

[tex]\begin{gathered} y=-6(0)+8 \\ y=8 \end{gathered}[/tex]

The first point is (0, 8)

Substitute x by 1

[tex]\begin{gathered} y=-6(1)+8 \\ y=-6+8 \\ y=2 \end{gathered}[/tex]

The 2nd point is (1, 2)

Now we can draw the graph

You can see the two points (0, 8) and (1, 2)

Ver imagen ShaiaU653354
Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
what's the percentage of 1/8 ?
a summary about concussions
Please help solve, thanks in advance!
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
Please help solve, thanks in advance!
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the