29LavenderAlison 29LavenderAlison
  • 04-08-2022
  • Mathematics
contestada

Please help due today. (43/7÷ x+32/9) ÷25/6=4/3

Respuesta :

adioabiola
adioabiola adioabiola
  • 05-08-2022

The solution to the equation as given in the task content is; x = -3.47.

What is the solution of the equation in discuss?

It follows from the task content that the equation given is; (43/7÷ x+32/9) ÷25/6=4/3

(43/7÷ x+32/9) = 25/6 × 4/3

(43/7÷ x+32/9) = 100/18

x +32/9 = 43/7 ÷ 100/18

x + 32/9 = 774/700

x = 774/700 - 32/9

x = -3.47.

Read more on equation solution;

https://brainly.com/question/25678139

#SPJ1

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
is a centimeter one tenth or one hundredth or a meter
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what is 0.00001267 is scientific notation
Why did the American public mostly oppose joining the League of Nations after WWI?
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
what is the lcd of 10/11,29/44