MONI229 MONI229

02-02-2017
Physics

contestada

A 3-kg mass is in free fall. What is the velocity of the mass after 7 seconds??

Respuesta :

standardbeauty standardbeauty

06-02-2017

69 ms. I hope that helps

Answer Link

Otras preguntas

What nursing actions best promote communication when obtaining a nursing history? select all that apply?

Read the following passage written by a teen hero: I want to be a vocal advocate for nature. I reject the idea that I am too young to make a difference. I recen

I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50

what is the answer to #16???? Helpppppp

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________

(hc) "in the government of this commonwealth, the legislative department shall never exercise the executive and judicial powers, or either of them. the executiv

Don’t know how to this, solve for x

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double