shlndrtchncltbchnnl shlndrtchncltbchnnl

03-04-2021
History

contestada

who is the first president of Nepal ?

Respuesta :

callbloodshot callbloodshot

03-04-2021

Answer:

ram baran Yadav was the first president of nepal

Answer Link

vminkookb0 vminkookb0

03-04-2021

Explanation:

the first president of nepal was Ram Baran Yadav.

Answer Link

Otras preguntas

If you balance a book on your head, you are not doing work on the book because a Doing work requires moving an object. b You are not applying any force to

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What is the product of 3/4 and 6/7

Suppose that two sources of sound produce waves of the same exact amplitude and frequency, but are out of phase by one-half of a wavelength. What will the end r

Powder Ski Shop reports inventory using lower-of-cost-or-market. Below is information related to its year-end inventory. Inventory Quantity Cost Market Ski jack

Which of the following are NOT correctly matched? A. severe combined immunodeficiency syndrome (SCID): genetic defect resulting in a shortage of B and/or T cell

I Am very confused about this question ❔ Ill give all my points!!

Help new here please

Select the equation that represents a problem that opens down from a vertex of (32,26) and has a focus located 20 units away from the vertex

What lengths do the Lionfish grow to?