natalietermain natalietermain
  • 03-03-2021
  • Mathematics
contestada

c=3.95p what is the slope

Respuesta :

achezz
achezz achezz
  • 03-03-2021

Step-by-step explanation:

I think it's 3.95!

this would be the only option!

Answer Link
irspow
irspow irspow
  • 03-03-2021

Answer:

Step-by-step explanation:

The slope is the coefficient of the independent variable, in this case 3.95

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
What was George Washington's nickname?
Write expression using the distributive property to find the product of 7 times 63
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
what is 0.00001267 is scientific notation
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup