kb04
kb04 kb04
  • 04-02-2021
  • Mathematics
contestada

Question 1
Find the measure of each angle indicated.

Question 1 Find the measure of each angle indicated class=

Respuesta :

25Abby86
25Abby86 25Abby86
  • 04-02-2021

Answer:

90

Step-by-step explanation:

Answer Link
devishri1977
devishri1977 devishri1977
  • 04-02-2021

Answer:

90

Step-by-step explanation:

x + 70 =120       {Exterior angle theorem}

        x = 120 - 70

       x = 50

y = x     {Vertically opposite angles}

y = 50

z + 50 + 40 = 180          {Angle sum property}

 z + 90  = 180

          z = 180 - 90

          z = 90

Ver imagen devishri1977
Answer Link

Otras preguntas

You are on standby at a sporting event when an infant nearby suddenly begins to cough
Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
I need the answer and the path work ok
It is illegal for a minor to even attempt to purchase alcohol. a. True b. False
How did the triple alliance and the triple entente change during the war?
List and briefly describe each of the five strength training principles. (Site 1)
Mi abuelo no es joven. Es _____
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat