lolCloud lolCloud
  • 04-02-2021
  • Mathematics
contestada

6. How much heat is lost cooling 25 grams of water from 90°C to 45°C?

6 How much heat is lost cooling 25 grams of water from 90C to 45C class=

Respuesta :

evgeniylevi
evgeniylevi evgeniylevi
  • 04-02-2021

Answer:

4,7025 (kJ).

Step-by-step explanation:

1) according to the condition: m=25 gr.; t₂=90; t₁=45; c=4.18 J/(g°C);

2) the formula of required heat is

Q=c*m*(t₂- t₁);

3) according to the formula of heat:

Q=4.18*25*45=4702.5 (J).

Answer Link

Otras preguntas

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
where are the three parts of an atom located
What would be the most likely effect of one company buying a competitor?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many times does four go into 153 ? What Is the remainder ?
What is the sum of 6/10 plus 7/12
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
4.2meters= how many centimeter