beyonceforda32 beyonceforda32
  • 01-11-2016
  • Social Studies
contestada

At the arraignment, an attorney is to be provided for the defendant free of charge if necessary.true or false

Respuesta :

madezinj madezinj
  • 01-11-2016
this statement is true !
Answer Link
ImLookingAtMyPencil ImLookingAtMyPencil
  • 01-11-2016
true because they were willing to give otherwise it would be rude,and its in the constitution
Answer Link

Otras preguntas

an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
define concentric circles
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
i need help with this question
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Susan ........ (Run) to school because she was late.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5