Seudónimo
Seudónimo
04-01-2021
Mathematics
contestada
What is the answer??
I NEED 2 KNOW!! =~=
Respuesta :
michaela5dueck
michaela5dueck
04-01-2021
A because the square is in the (10) place and the circle is in the (1) place and 10 is 10 times bigger than 1
Answer Link
VER TODAS LAS RESPUESTAS ( 47+ )
Otras preguntas
who is the current US President
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
A rock is radiometrically dated to determine its age. The laboratory doing the dating discovers that the rock currently has 200 atoms of radioactive parent isot
Which organism will have DNA most similar to the bird? Why?
Some compounds are not active carcinogens until they are converted into cancer-causing compounds in the body. To identify potential carcinogens using the Ames t
Two slits separated by a distance of d = 0.12 mm are located at a distance of D = 0.63 m from a screen. The screen is oriented parallel to the plane of the slit
A force of 40 N is applied in a direction perpendicular to the end of a 9 m long bar that pivots about its other end. Find the torque that this force produces a
Is the relation {(-2.2)(3,5)(4,2),(3,-1) a function
Which of these statements best captures the central idea of this article? A. The brain can be hurt by laughter if it happens too often. B. Mirthful laughter can
Workmen used 3/4 of a pallet of pavers to build 6 steps leading up to the mansion. Each step they built was the same size. How many pallets did they use for eac