chickennuggets71 chickennuggets71

02-12-2020
Mathematics

contestada

The difference of a number and 6 is the same as 5 times the sum of the number and 2. What is the number?
A. -4
B.-2
C.-1
D. 1

Respuesta :

altavistard altavistard

02-12-2020

Answer:

n = -4

Step-by-step explanation:

You must write and solve a symbolic equation.

n - 6 = 5(n + 2), or

n - 6 = 5n + 10

Combining like terms, we get:

-16 = 4n,

and so n = -4

Answer Link

chasingtheatlantic chasingtheatlantic

11-03-2022

Answer:

A. -4

Step-by-step explanation:

Answer Link

Otras preguntas

Your religious identity is only important for you within your family and does not matter in the public sphere.

You should always wear your seatbelt just in case the car comes to an abrupt stop. The seatbelt will hold you in place so that your body does not continue movin

The brackets are indicating a(n) _____ bond. the brackets are indicating a(n) _____ bond. hydrogen polar covalent single (nonpolar) covalent hydrophobic ionic

what is r in this equation? πr^2=42π

For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle

. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm

Need help on this geometry please someone ?

Business contracts or marriage licenses are found in which stage of relational development

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what was considered an act of war in 1914?