emilylou218 emilylou218
  • 03-07-2016
  • Mathematics
contestada

What is the equation in standard form of a parallel line that passes through (0,-2)?

Respuesta :

AL2006
AL2006 AL2006
  • 03-07-2016
'Parallel' means parallel TO something else.  A single line all by itself
is not "a parallel line", until we know the other line that it's parallel TO.

There are an infinite number of lines that pass through (0, -2). 
Give us another line, and we'll find the one that's parallel to it.
Answer Link

Otras preguntas

A manager states that his process is really working well. Out of 1,500 parts, 1,477 were produced free of a particular defect and passed inspection. a. Calculat
-4p+(-2)+2p+3 combine like terms
What does corintine mean?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Goods or services in standard-cycle markets reflect: a. numerous first-mover advantages. b. organizations that serve a mass market. c. an inability to sustain a
What is the answer to 5+8 this equation? 1+4=.5 2+5=12 3+6=21 5+8=
The common ratio of a geometric series is \dfrac14 4 1 ​ start fraction, 1, divided by, 4, end fraction and the sum of the first 4 terms is 170
find the missing value in the equivalent ratio 18:27=
Can someone plz write a story about literally anything, about a paragraph long, using ALL of these words? Thxxxxxxxxx ;) adapt attest dovetail enormity falter f
12b. Choose the correct form of fewer/less to complete the sentences. 1. There were ... outdoor sport fans in the past. 2. I drank ... water than she did at the