1546942 1546942
  • 01-10-2019
  • History
contestada

what document includes that statement, "to secure the blessings of liberty'?

Respuesta :

paigen20016
paigen20016 paigen20016
  • 01-10-2019

he Blessings of Liberty: The U.S. Constitution. Constitution of the United States of America. Image courtesy of the National Archives and Records Administration.

Answer Link

Otras preguntas

Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 examples of ionic compound?
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
How do you write fifty-seven thousand,eighteen. In standard form