Miracley413 Miracley413
  • 02-04-2019
  • Mathematics
contestada

Convert 3.5 yards to feet round answers to the nearest tenth

Convert 35 yards to feet round answers to the nearest tenth class=

Respuesta :

leximeyers30
leximeyers30 leximeyers30
  • 03-04-2019

Answer:

The answer is B. 10.5 feet

Step-by-step explanation:

In every one yard there's three feet.

3.5 X 3 = 10.5

Hope this helps :)

Answer Link

Otras preguntas

Choose the best Spanish word to complete the sentence. Viviana __________ en una linda ciudad. vivó vivió vivíamos vivían
Compare the pressure exerted by the liquid at points A, B and C. Justify your answer
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
5 sources about Cyber bullying Giving brainliest:)
can someone describe Yala Korwin-Polish
In your response, you will be assessed on the following. Respond to the prompt with a historically defensible thesis or claim that establishes a line of reasoni
Change Hee bought 8.2 pounds of coffee that cost $6.85 per pound. How much did he spend on coffee? ​
What's the best song on Clouds the mixtape?​
Need the answer will mark as brainliest
What is the value of the expression 8 3/5 (-22.8)?