Meiyuh1
Meiyuh1
02-12-2018
Social Studies
contestada
how was the way of life in new england
Respuesta :
mxdelyncarter
mxdelyncarter
03-12-2018
During the 1600s and 1700s, hundreds of thousands of Africans were forced to work as slaves in the colonies. Most New England families lived in small houses with one main room. They cooked on the fireplace and slept on mattresses near the fire.
Answer Link
VER TODAS LAS RESPUESTAS ( 99+ )
Otras preguntas
Byron uses a poetic technique called _____ to force the reader to _____. A. enjambment; move from one line to the next without pause B. iambic pentameter; pa
does mercury have a magnetic field
Homosociality reflects children's tendency to prefer social interactions with
Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.
A major weakness of the new constitution was the bill of rights. a. True b. False
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
