Jetc34
Jetc34 Jetc34
  • 01-10-2018
  • Mathematics
contestada

please help on this one

please help on this one class=
please help on this one class=

Respuesta :

alippiatt alippiatt
  • 01-10-2018

The answer is D because it passes the horizontal line test.  

Answer Link
tmaisun tmaisun
  • 01-10-2018
B because a horizontal line
Answer Link

Otras preguntas

How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
the perimeter of a square 116ft ?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
How do I do trebuchet calculations????? Help me please
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5