mollie2 mollie2
  • 04-03-2016
  • Mathematics
contestada

I have €180. I exchanged it at €1.2 to £1 . how much do I get back in sterling

Respuesta :

AL2006
AL2006 AL2006
  • 04-03-2016

               (180 €) x (1 £ / 1.2 €)

           =  (180 · 1 / 1.2) x ( € · £ / € )

           =     £ 150         minus the exchanger's commission.
Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
What are some methods used by Mussolini to rise to power?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Round 46.895 to the nearest tenth
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take